Genetics (Mef2 C) Essay

1437 words - 6 pages

Single nucleotide polymorphism of myocyte enhancer factor 2C (MEF2C) gene and correlation analysis with meat traits in Chinese Simmental
Name, name……


Keywords Chinese Simmental Myocyte enhancer factor 2C Polymorphism Carcass traits

A family of transcription factors, the myocyte enhancer factor-2(MEF2) family, has been shown to play a pivotal role in morphogenesis and myogenesis of skeletal, cardiac, and smooth muscle cells. In vertebrates, there are four MEF2 genes, referred to as MEF2A,- B ,- C and -D that are located on different chromosomes. It is shown that the gene product of the MEF2 family had the special and unique domain, MADS-like region, which ...view middle of the document...

Despite, more and more data provide evidence that MEF2C is an essential factor for vertebrate skeletal muscle development and differentiation, it is little known about how this gene is regulated at the transcriptional and translational level, even the specific structure or functional region, especially in bovine.
Because of the economic importance of the bovine species to the livestock industry, it appears clearly essential to clarify some of the factors related to MEF2C genes expression. The present study was conducted to identify new polymorphisms in the promoter region of the bovine MEF2C gene in Chinese Simmental, and to determine the relationship between the MEF2C gene and the productive traits.
Materials and methods
Animals and DNA samples
Blood from 137 Chinese Simmental (Bos taurus) were collected and snap frozen using liquid nitrogen and then stored at -80°C pending analyses. The animals had grazed freely on nature pasture and had received a supplement of salt per 2–4 week interval at the IAS-CAAS, city of Beijing, China. Genomic DNA was extracted from blood using AxyPrep Blood Genomic DNA Midi/Maxi prep Kits(Axygen Inc. ,HangZhou, China) and stored in the eppendorf tubes contains ddH2O at -80°C.
Polymerase chain reaction (PCR) and sequencing
Basing on the sequences of the bovine chromosome 7 genomic contig (GenBank accession number: NC_007305) available in the GenBank database, 8 pairs of primers were designed using the Primer3 (v. 0.4.0)( (Table 1). They encompassed most of exons and the 5’UTR encompassed site of the promoter region to examine any potential SNP.(The MEF2C gene contains large number of poly-N as poly-G,C,A,T, that make the proper primer of few exons fail to be designed.)
The PCR was carried out in a reaction volume of 25μL, containing 1.0μL DNA (approximately 120ng/μL), 2μL 10mM/mL dNTP Mixture(2.5 mM/mL each dNTP), 2.5μL EX Taq buffer (Mg2+ Plus),0.5μL 10 μM/μL forward primer, 0.5μL 10μM/μL reverse primer, 0.5 μL EX Taq DNA polymerase (5U/μL, TAKARA BIO Inc, JAPAN.) and 16.0 μL ddH2O. Thermal cycling parameters were as follows: 5 min at 94 °C, 35 cycles of amplification (30 s at 94 °C, 30 s at individual Tm, 60 s at 72 °C), and finally 7 min at 72 °C. The 132 purified PCR products (using AxyPrep DNA Gel Extraction Kit,Axygen Inc.,china )were selected and sequenced on both strands using an ABI373X DNA Analyzer (Applied Biosystems Inc.) at the Sango Biotechnology Company (Shanghai, China)
Table 1 Forward (F) and reverse (R) primers for amplification of the MEF2C gene
Locus | Primer sequences | Mutationa | Region | Positionb | Length | Tm |
P1 | F: ACCTGATTAGAAAGTTCATGGC | | Promoter | -1389 to -1125 | 264 | 56 |
P2 | F: GAGTCAACGGTTTGGGATT | | Promoter | -591 to -226 | 305 | 57.3 |
E2 | F: TGGCTTGCTATTAAAGTCGT | | Exon 2 | 53908-54138 |...

Other Papers Like Genetics - (MEF2C)

A Heart Of Darkness Essay

1748 words - 7 pages In this short story, there are frequent significant subject and ideas that make the story, "A Heart of Darkness," by Joseph Conrad, and haunting novel. The main theme is absolute white power over the natives. The theme validates the corruption, and the dependence caused by the white people as they took over the Congo. White men were giving all the power; they had no self-control, and in the end they did not use wisely. The white men became

The Aspects Of Vulnerability Among The Exploited In Medical Research

2287 words - 10 pages Essentially, everyone is in some state of vulnerability. However, some of us are more susceptible to harm due to our vulnerabilities. The susceptible are the individuals with the greatest risk. These individuals risk the loss of their autonomy, and maybe even their lives. Vulnerable populations can be found in every subset of society. However, as previously mentioned, there are some vulnerable populations that are at an even greater risk than

The Hitchhiker’S Guide To The Galaxy

1171 words - 5 pages The Hitchhiker’s Guide to the Galaxy As the human race makes life-changing discoveries, it is made apparent that there is always more to learn as the universe, instead of becoming familiar, is becoming absurd. The Hitchhiker’s Guide to the Galaxy, written by Douglas Adams, as well as the 2005 film adaption, portrays absurdity to be an all-encompassing system in the universe. Through the introduction and attempt to understand lack of reason, the

The Ford Motor Company Wage Increase Of 1914 And The Theory Of Incentives And Efficiency Wages

1252 words - 6 pages ‘It’s not the employer who pays the wages. Employers only handle the money. It is the customer who pays the wages’ (Henry Ford, cited in Johnson and Weinstein 2004, p. 2). When the Ford Motor Company announced that it would more than double the wages of its workers in January 1914 to a ‘five-dollar day’ minimum, was this a contradiction to Henry Ford’s statement? If customers are actually the ultimate payers of wages, then more than

Historical Analysis Of The Economical Breakthroughs Of The Industrial Revolution

1396 words - 6 pages A Historical Analysis of the Economical Breakthroughs of the Industrial Revolution During the Industrial Revolution, many elements of society experienced huge breakthroughs that would change the way they functioned forever. Economics were definitely one of them. With many new inventions and many factories appearing, many, many, more resources were being created than ever before. Also, all of the revenue from these resources was being given to

Leadership Portrayed in Monologue from Shakespeare’s Henry V

1214 words - 5 pages Leadership is defined as a socially constructed process and which also affect organizational future outcomes. Leader is someone at high position who have overall duty for an organization, she or he decide what to do and the way how to achieve it. (Carter and Greer, 2013)The role of leader is extremely important for an organization, leader use their own power to influence the followers though many different ways such as motivation in order to

Cuba Civil Rights

1906 words - 8 pages Picture a country that has limits on how much you can make random government imprisonments and more what do you do. That is the situation for the eleven million seventy-five thousand two hundred forty-four people of Cuba since the takeover of Fidel Castro. The US is opposed to Castro taking control of Cuba. Castro managed to ease the United States nerves when he said that Cuba was against all forms of communism. According to Lana Wylie the Union

US Freight System

1273 words - 6 pages General Environment Each American requires the movement of approximately 40 tons of freight per year across the freight network. This includes everything from shirts to lawn mower to orange juice. • As the U.S. population expands, the U.S. freight system will be called upon to meet the demands of a larger population • Between 2010 and 2035, the system will experience a 22 percent increase in the total amount of tonnage it moves • By 2050, with

Democratic Peace Theory

1852 words - 8 pages Intro: US Presidents have made it a goal during their term(s) in office to establish a good relationship with foreign countries and even try to improve upon existing connections with our allies. Some believe it is to prevent conflicts between the countries while others dispute that it is a threat assessment by the United States to pick and choose their friends and enemies. Preventing conflict between two democracies or countries that practice

Booker T. Washington

1621 words - 7 pages “Success is to be measured not so much by the position that one has reached in life as by the obstacles which he has overcome” –Booker T. Washing. Booker Taliaferro Washington was born in Hale’s Ford, Virginia on April 5th, 1856 to Jane Burroughs and an unknown White man. Washington was married three times. His first wife was Fannie N. Smith from Malden, West Virginia. Booker and Fannie were married in the summer of 1882 and had one child

Corn, Broccoli, Grass Or Balanced

2611 words - 11 pages About a century ago, there was not an epidemic of diet-related illness, a bizarre account of destroyed farmland, dead zones in our oceans created by chemical run-off spilling into the waterways, and there sure was not millions of people questioning the moral ethics of their diet. In the Omnivore’s Dilemma: A Natural History of Four Meals, the author Michael Pollan goes on a journey to investigate the sources of the nation’s food supply, for which

Related Essays

Freedom And Responsibility Essay

2141 words - 9 pages Built within the Constitution of the United States are specifically defined freedoms that are guaranteed to all citizens. Conversely, with every constitutional freedom there comes a corresponding responsibility. On September 25, 1789, the state legislature’s twelve proposed amendments were transmitted by congress, the first two dealing with congressional representation and congressional pay. The following numbers three through twelve were

Hate Crime Laws Essay

2348 words - 10 pages On June 7, 1998, 49-year-old James Byrd Jr. of Texas accepted a ride from three white men, who then beat him severely, urinated on him, chained him by his ankles to the back of their pick-up truck, dragged him for three miles into the countryside, and dumped his corpse in front of an African-American cemetery (Graczyk). A little over a year later, a jury sentenced ring leader John King to death by lethal injection (“Man Executed for Dragging

Rational Emotional Behavior Therapy Case Study Conceptualization And Treatment Plan

2140 words - 9 pages Rational Emotional Behavior Therapy Case Study of Sarah: A Conceptualization and Treatment Plan Rational emotive behavior therapy, REBT, was developed by Albert Ellis and holds the central belief that the events in our lives do not cause our disturbances but that they are instead caused by our view of the events (Murdock, 2009). Murdock (2009) states that “people are seen as responsible for their behavior” (p. 279) but, because they are

Holidays In Albania Essay

1636 words - 7 pages Have you ever thought about having exciting and incredibly cheap vacations? Albania might be the right choice. According to My Travel Guide, Albania is ranked the fourth among ten places worth visiting in Eastern Europe (“Top 10 Eastern European Destinations”). One can encounter three kinds of vacations in this Mediterranean country: winter, summer, and cultural. The ideal places to spend your winter vacations are the Albanian Alps. They are